../../tmp/servers/virsirnadb/1233527755
Result for your query siRNA sequence
| RED | =100 % Complementary sequence |
| . | =Identical residue |
| blue alphabets | =mismatch |
| _ | =Gap |
| Acc number | Strain name | Start | Alignment | End | % Identity |
| Query | virsi3002 | 1 | gtgcgatccagatttgttttg | 21 | |
| V01148.1 | Genome of human poliovirus type 1 (Mahoney strain). (One of two versi | 6611 | ..................... | 6631 | 100 |
| V01150.1 | Human poliovirus strain Sabin 1 complete genome, strain Sabin 1 | 6619 | ..................... | 6639 | 100 |
| AJ416942.1 | Human poliovirus 1 genomic RNA for polyprotein, strain CHAT 10A-11 | 6619 | ..................... | 6639 | 100 |
| AJ430385.1 | Human poliovirus 1 genomic RNA for polyprotein gene, strain Cox | 6619 | ..................... | 6639 | 100 |
| AY184219.1 | Human poliovirus 1 strain Sabin 1, complete genome | 6619 | ..................... | 6639 | 100 |
| AF538840.1 | Human poliovirus 1 isolate TCDCE01-135, complete genome | 6589 | ..................... | 6609 | 100 |
| AF538841.1 | Human poliovirus 1 isolate TCDC01-113, complete genome | 6619 | ..................... | 6639 | 100 |
| EF682343.1 | Human poliovirus 1 strain USA10774 polyprotein gene, complete cds | 6593 | ..................... | 6613 | 100 |
| EF682344.1 | Human poliovirus 1 strain USA10775 polyprotein gene, complete cds | 6593 | ..................... | 6613 | 100 |
| EF682346.1 | Human poliovirus 1 strain USA10780 polyprotein gene, complete cds | 6593 | ..................... | 6613 | 100 |
| EF682347.1 | Human poliovirus 1 strain USA10781 polyprotein gene, complete cds | 6593 | ..................... | 6613 | 100 |
| EF682348.1 | Human poliovirus 1 strain USA10782 polyprotein gene, complete cds | 6593 | ..................... | 6613 | 100 |
| EF682349.1 | Human poliovirus 1 strain USA10771 polyprotein gene, complete cds | 6593 | ..................... | 6613 | 100 |
| EF682350.1 | Human poliovirus 1 strain USA10772 polyprotein gene, complete cds | 6593 | ..................... | 6613 | 100 |
| EF682351.1 | Human poliovirus 1 strain USA10778 polyprotein gene, complete cds | 6593 | ..................... | 6613 | 100 |
| EF682352.1 | Human poliovirus 1 strain USA10770 polyprotein gene, complete cds | 6593 | ..................... | 6613 | 100 |
| EF682353.1 | Human poliovirus 1 strain USA10777 polyprotein gene, complete cds | 6593 | ..................... | 6613 | 100 |
| EF682354.1 | Human poliovirus 1 strain USA10779 polyprotein gene, complete cds | 6593 | ..................... | 6613 | 100 |
| EF682355.1 | Human poliovirus 1 strain USA10776 polyprotein gene, complete cds | 6593 | ..................... | 6613 | 100 |
| EF682356.1 | Human poliovirus 1 strain USA10784, complete genome | 6619 | ..................... | 6639 | 100 |
| EF682357.1 | Human poliovirus 1 strain USA10785, complete genome | 6619 | ..................... | 6639 | 100 |
| EF682358.1 | Human poliovirus 1 strain USA10783, complete genome | 6619 | ..................... | 6639 | 100 |
| EF682359.1 | Human poliovirus 1 strain USA10786, complete genome | 6619 | ..................... | 6639 | 100 |
| EU794953.1 | Human poliovirus 1 isolate A21 polyprotein gene, complete cds | 6571 | ..................... | 6591 | 100 |
| EU794954.1 | Human poliovirus 1 isolate A49 polyprotein gene, complete cds | 6571 | ..................... | 6591 | 100 |
| EU794955.1 | Human poliovirus 1 isolate A63 polyprotein gene, complete cds | 6571 | ..................... | 6591 | 100 |
| EU794956.1 | Human poliovirus 1 isolate A84 polyprotein gene, complete cds | 6571 | ..................... | 6591 | 100 |
| EU794957.1 | Human poliovirus 1 isolate A88 polyprotein gene, complete cds | 6571 | ..................... | 6591 | 100 |
| EU794958.1 | Human poliovirus 1 isolate A91 polyprotein gene, complete cds | 6571 | ..................... | 6591 | 100 |
| EU794959.1 | Human poliovirus 1 isolate A102 polyprotein gene, complete cds | 6571 | ..................... | 6591 | 100 |
| EU794960.1 | Human poliovirus 1 isolate A105 polyprotein gene, complete cds | 6571 | ..................... | 6591 | 100 |
| EU794961.1 | Human poliovirus 1 isolate A118 polyprotein gene, complete cds | 6571 | ..................... | 6591 | 100 |
| EU794962.1 | Human poliovirus 1 isolate A199 polyprotein gene, complete cds | 6571 | ..................... | 6591 | 100 |
| FJ769378.1 | Human poliovirus 1 strain CHN8184/GZ/CHN/2004, complete genome | 6619 | ..................... | 6639 | 100 |
| FJ769379.1 | Human poliovirus 1 strain CHN8229-1/GZ/CHN/2004, complete genome | 6619 | ..................... | 6639 | 100 |
| FJ769380.1 | Human poliovirus 1 strain CHN8229-2/GZ/CHN/2004, complete genome | 6619 | ..................... | 6639 | 100 |
| FJ769381.1 | Human poliovirus 1 strain CHN8229-3/GZ/CHN/2004, complete genome | 6619 | ..................... | 6639 | 100 |
| FJ769382.1 | Human poliovirus 1 strain CHN8233c/GZ/CHN/2004, complete genome | 6619 | ..................... | 6639 | 100 |
| FJ769383.1 | Human poliovirus 1 strain CHN8225c/GZ/CHN/2004, complete genome | 6619 | ..................... | 6639 | 100 |
| FJ769384.1 | Human poliovirus 1 strain CHN8248c/GZ/CHN/2004, complete genome | 6619 | ..................... | 6639 | 100 |
| FJ769385.1 | Human poliovirus 1 strain CHN8264c/GZ/CHN/2004, complete genome | 6619 | ..................... | 6639 | 100 |
| AF538842.1 | Human poliovirus 1 isolate TCDC01-330, complete genome | 6611 | ...t................. | 6631 | 95 |
| AF538843.1 | Human poliovirus 1 isolate TCDC01-861, complete genome | 6611 | ...t................. | 6631 | 95 |
| AY928383.1 | Human poliovirus 1 isolate d261-2002037607 polyprotein gene, complete | 6611 | ...t................. | 6631 | 95 |
| AY928384.1 | Human poliovirus 1 isolate d224-2002037606 polyprotein gene, complete | 6611 | ...t................. | 6631 | 95 |
| AY928385.1 | Human poliovirus 1 isolate d054-2002037604 polyprotein gene, complete | 6611 | ...t................. | 6631 | 95 |
| AY928386.1 | Human poliovirus 1 isolate d179-2002037605 polyprotein gene, complete | 6611 | ...t................. | 6631 | 95 |
| AY928387.1 | Human poliovirus 1 isolate d018-2002037602 polyprotein gene, complete | 6611 | ...t................. | 6631 | 95 |
| EF682345.1 | Human poliovirus 1 strain USA10773 polyprotein gene, complete cds | 6593 | ...t................. | 6613 | 95 |
| EU794963.1 | Human poliovirus 1 isolate A449 polyprotein gene, complete cds | 6571 | ...t................. | 6591 | 95 |
| X04468.1 | Poliovirus type 3 strain 23127 complete genome | 6615 | _..t................. | 6634 | 90 |
| AY278553.1 | Human poliovirus 1 isolate P1W/Bar65 (19276), complete genome | 6616 | _..t................. | 6635 | 90 |
| AY278553.1 | Human poliovirus 1 isolate P1W/Bar65 (19276), complete genome | 2857 | ______.........._____ | 2866 | 47 |
| AF416342.1 | Human poliovirus 1 isolate HAI01-013, complete genome | 6620 | _..t................. | 6639 | 90 |
| AF416342.1 | Human poliovirus 1 isolate HAI01-013, complete genome | 2861 | ______..........a.a.. | 2875 | 61 |
| AF111953.2 | Human poliovirus 1 isolate CHN-Hebei/91-2, complete genome | 6624 | _..t................. | 6643 | 90 |
| EF555644.1 | Human enterovirus 99, complete genome | 6626 | _.....c.............. | 6645 | 90 |
| AB180070.1 | Human poliovirus 1 gene for polyprotein, complete cds, isolate:Mindan | 6619 | ...t..c.............. | 6639 | 90 |
| AB180071.1 | Human poliovirus 1 gene for polyprotein, complete cds, isolate:Luzon- | 6619 | ...t..c.............. | 6639 | 90 |
| AB180072.1 | Human poliovirus 1 gene for polyprotein, complete cds, isolate:Luzon- | 6619 | ...t..c.............. | 6639 | 90 |
| AB180073.1 | Human poliovirus 1 gene for polyprotein, complete cds, isolate:Luzon- | 6619 | ...t..c.............. | 6639 | 90 |
| D00625.1 | POL2CG1 Human poliovirus 2 genomic RNA, complete genome | 6619 | _..t..c.............. | 6638 | 85 |
| M12197.1 | POL2LAN Poliovirus type 2 (Lansing strain), complete genome | 6619 | _..t..c.............. | 6638 | 85 |
| AF405666.1 | Human poliovirus 1 isolate HAI01007, complete genome | 6620 | _..t...........a..... | 6639 | 85 |
| AF405666.1 | Human poliovirus 1 isolate HAI01007, complete genome | 2861 | ______..........a.a.. | 2875 | 61 |
| AY238473.1 | Human poliovirus 2 strain MEF-1 polyprotein gene, complete cds | 6619 | _..t..c.............. | 6638 | 85 |
| AF499640.1 | Human coxsackievirus A18 strain G13, complete genome | 6637 | _..t..c.............. | 6656 | 85 |
| AF499640.1 | Human coxsackievirus A18 strain G13, complete genome | 2881 | ______.........._____ | 2890 | 47 |
| AF546702.1 | Human coxsackievirus A21 strain Kuykendall, complete genome | 6585 | _..t..c.............. | 6604 | 85 |
| AF465513.1 | Human coxsackievirus A18 strain G-13, complete genome | 6637 | _..t..c.............. | 6656 | 85 |
| AF465513.1 | Human coxsackievirus A18 strain G-13, complete genome | 2881 | ______.........._____ | 2890 | 47 |
| AF465515.1 | Human coxsackievirus A21 strain Kuykendall, complete genome | 6585 | _..t..c.............. | 6604 | 85 |
| AF111961.2 | Human poliovirus 1 isolate CHN-Guangdong/92-2, complete genome | 6624 | _..t..c.............. | 6643 | 85 |
| DQ890388.1 | Human poliovirus 2 strain PER8310769, complete genome | 6619 | _..t...........a..... | 6638 | 85 |
| DQ890388.1 | Human poliovirus 2 strain PER8310769, complete genome | 3409 | ________...c......... | 3397 | 57 |
| EF555645.1 | Human enterovirus 102, complete genome | 6617 | _..t...........a..... | 6636 | 85 |
| FJ914252.2 | Human poliovirus 3 strain SWI10947, complete genome | 6615 | _..t..c.............. | 6634 | 85 |
| AJ293918.1 | Human poliovirus type 3 complete genome, live-attenuated strain USOL- | 6615 | .........t..cc....... | 6635 | 85 |
| AJ293918.1 | Human poliovirus type 3 complete genome, live-attenuated strain USOL- | 5645 | ______..g.........___ | 5634 | 52 |
| AF499635.1 | Human coxsackievirus A1 strain Tompkins, complete genome | 6573 | ...t.........g.c..... | 6593 | 85 |
| X00595.1 | Poliovirus type 2 genome (strain Sabin 2 (P712, Ch, 2ab)) | 6619 | _..t.........c.a..... | 6638 | 80 |
| X00595.1 | Poliovirus type 2 genome (strain Sabin 2 (P712, Ch, 2ab)) | 3409 | ________...c......... | 3397 | 57 |
| AF462418.1 | Human poliovirus 1 99/056-252-14, complete genome | 6620 | _..t.........c.a..... | 6639 | 80 |
| AF462418.1 | Human poliovirus 1 99/056-252-14, complete genome | 3410 | ________...c......... | 3398 | 57 |
| AF462419.1 | Human poliovirus 1 RUS-1161-96-001, complete genome | 6620 | _..t.........c.a..... | 6639 | 80 |
| AF462419.1 | Human poliovirus 1 RUS-1161-96-001, complete genome | 3410 | ________...c......... | 3398 | 57 |
| AY184220.1 | Human poliovirus 2 strain Sabin 2, complete genome | 6619 | _..t.........c.a..... | 6638 | 80 |
| AY184220.1 | Human poliovirus 2 strain Sabin 2, complete genome | 3409 | ________...c......... | 3397 | 57 |
| AF541919.1 | Human poliovirus 3 isolate PV3/NOR/01/8 polyprotein mRNA, complete cd | 6601 | _..t.........c.a..... | 6620 | 80 |
| AF541919.1 | Human poliovirus 3 isolate PV3/NOR/01/8 polyprotein mRNA, complete cd | 3391 | ________...c......... | 3379 | 57 |
| AY177685.1 | Human poliovirus 2, complete genome | 6619 | _..t.........c.a..... | 6638 | 80 |
| AY177685.1 | Human poliovirus 2, complete genome | 3409 | ________...c......... | 3397 | 57 |
| AY278549.1 | Human poliovirus 2 isolate P2S/Mog65-3 (20120), complete genome | 6619 | _..t.........c.a..... | 6638 | 80 |
| AY278550.1 | Human poliovirus 2 isolate P2S/Mog65-1 (20003), complete genome | 6619 | _..t.........c.a..... | 6638 | 80 |
| AY278550.1 | Human poliovirus 2 isolate P2S/Mog65-1 (20003), complete genome | 3409 | ________...c......... | 3397 | 57 |
| AY278552.1 | Human poliovirus 2 isolate P2S/Mog65-2 (20077), complete genome | 6619 | _..t.........c.a..... | 6638 | 80 |
| AY278552.1 | Human poliovirus 2 isolate P2S/Mog65-2 (20077), complete genome | 3409 | ________...c......... | 3397 | 57 |
| AF499642.1 | Human coxsackievirus A20 strain IH35, complete genome | 6616 | _..t.........c.a..... | 6635 | 80 |
| AF499642.1 | Human coxsackievirus A20 strain IH35, complete genome | 5651 | ...att............___ | 5634 | 71 |
| AF499642.1 | Human coxsackievirus A20 strain IH35, complete genome | 2857 | ______..........a.a._ | 2870 | 57 |
| AF465514.1 | Human coxsackievirus A20 strain IH Pool 35, complete genome | 6616 | _..t.........c.a..... | 6635 | 80 |
| AF465514.1 | Human coxsackievirus A20 strain IH Pool 35, complete genome | 5651 | ...att............___ | 5634 | 71 |
| AF465514.1 | Human coxsackievirus A20 strain IH Pool 35, complete genome | 2857 | ______..........a.a._ | 2870 | 57 |
| AF111984.2 | Human poliovirus 1 isolate CHN-Jiangxi/89-1, complete genome | 6623 | _..t..c..g........... | 6642 | 80 |
| AF111984.2 | Human poliovirus 1 isolate CHN-Jiangxi/89-1, complete genome | 2864 | ______.........._____ | 2873 | 47 |
| DQ205099.1 | Human poliovirus 2 clone S2R9, complete genome | 6619 | _..t.........c.a..... | 6638 | 80 |
| DQ205099.1 | Human poliovirus 2 clone S2R9, complete genome | 3409 | ________...c......... | 3397 | 57 |
| DQ205099.1 | Human poliovirus 2 clone S2R9, complete genome | 5648 | ______..a.........___ | 5637 | 52 |
| DQ890387.1 | Human poliovirus 2 strain USA9810768, complete genome | 6619 | _..t.........c.a..... | 6638 | 80 |
| DQ890387.1 | Human poliovirus 2 strain USA9810768, complete genome | 3409 | ________...c......... | 3397 | 57 |
| EF026081.1 | Human coxsackievirus A24 strain Joseph, complete genome | 6638 | _..t..c...........c.. | 6657 | 80 |
| EF456707.1 | Human poliovirus 3 isolate K/2002 polyprotein gene, complete cds | 6571 | _..t.........c.a..... | 6590 | 80 |
| EF456707.1 | Human poliovirus 3 isolate K/2002 polyprotein gene, complete cds | 3361 | ________...c......... | 3349 | 57 |
| FM955278.1 | Human coxsackievirus A17, complete genome, genomic RNA, isolate cCA17 | 6637 | _..t.........c....c.. | 6656 | 80 |
| FM955278.1 | Human coxsackievirus A17, complete genome, genomic RNA, isolate cCA17 | 6085 | _..g.t..t.at......... | 6066 | 71 |
| FJ898290.1 | Human poliovirus 2 strain Sabine 2 isolate CHN3024/HN/CHN/1999, compl | 6619 | _..t.........c.a..... | 6638 | 80 |
| FJ898290.1 | Human poliovirus 2 strain Sabine 2 isolate CHN3024/HN/CHN/1999, compl | 3409 | ________...c......... | 3397 | 57 |
| HM107835.1 | Human poliovirus 2 isolate CHN8316, complete genome | 6619 | _..t.........c.a..... | 6638 | 80 |
| HM107835.1 | Human poliovirus 2 isolate CHN8316, complete genome | 3409 | ________...c......... | 3397 | 57 |
| X00596.1 | Poliovirus type 3 mRNA (vaccine strain Sabin 3 (Leon 12a1b)) | 6613 | _...........cc.a..c.. | 6632 | 76 |
| X00596.1 | Poliovirus type 3 mRNA (vaccine strain Sabin 3 (Leon 12a1b)) | 6487 | ____.t....ct......... | 6471 | 66 |
| X00925.1 | Poliovirus type 3 leon 12 a1b sequence (P3/Leon 12 a1b) | 6611 | _...........cc.a..c.. | 6630 | 76 |
| X00925.1 | Poliovirus type 3 leon 12 a1b sequence (P3/Leon 12 a1b) | 6485 | ____.t....ct......... | 6469 | 66 |
| K01392.1 | POL3L37 Poliovirus P3/Leon/37 (type 3), complete genome | 6611 | _...........cc.a..c.. | 6630 | 76 |
| K01392.1 | POL3L37 Poliovirus P3/Leon/37 (type 3), complete genome | 6485 | ____.t....ct......... | 6469 | 66 |
| AY184221.1 | Human poliovirus 3 strain Sabin 3, complete genome | 6611 | _...........cc.a..c.. | 6630 | 76 |
| AY184221.1 | Human poliovirus 3 strain Sabin 3, complete genome | 6485 | ____.t....ct......... | 6469 | 66 |
| AY948201.1 | Human poliovirus 2 isolate CHN1025 polyprotein gene, complete cds | 6620 | _...........cc.a..c.. | 6639 | 76 |
| AY948201.1 | Human poliovirus 2 isolate CHN1025 polyprotein gene, complete cds | 6494 | ____.t....ct......... | 6478 | 66 |
| FJ859058.1 | Human poliovirus 1 isolate 10050, complete genome | 6620 | _...........cc.a..c.. | 6639 | 76 |
| FJ859058.1 | Human poliovirus 1 isolate 10050, complete genome | 6494 | ____.t....ct......... | 6478 | 66 |
| FJ859058.1 | Human poliovirus 1 isolate 10050, complete genome | 3410 | ________...c......... | 3398 | 57 |
| FJ859059.1 | Human poliovirus 1 isolate 10086c, complete genome | 6620 | _...........cc.a..c.. | 6639 | 76 |
| FJ859059.1 | Human poliovirus 1 isolate 10086c, complete genome | 6494 | ____.t....ct......... | 6478 | 66 |
| FJ859059.1 | Human poliovirus 1 isolate 10086c, complete genome | 3410 | ________...c......... | 3398 | 57 |
| FJ859060.1 | Human poliovirus 1 isolate 10091c, complete genome | 6620 | _...........cc.a..c.. | 6639 | 76 |
| FJ859060.1 | Human poliovirus 1 isolate 10091c, complete genome | 6494 | ____.t....ct......... | 6478 | 66 |
| FJ859060.1 | Human poliovirus 1 isolate 10091c, complete genome | 3410 | ________...c......... | 3398 | 57 |
| FJ859061.1 | Human poliovirus 1 isolate 10092c, complete genome | 6620 | _...........cc.a..c.. | 6639 | 76 |
| FJ859061.1 | Human poliovirus 1 isolate 10092c, complete genome | 3410 | ________...c......... | 3398 | 57 |
| FJ859062.1 | Human poliovirus 1 isolate 10094c, complete genome | 6620 | _...........cc.a..c.. | 6639 | 76 |
| FJ859062.1 | Human poliovirus 1 isolate 10094c, complete genome | 6494 | ____.t....ct......... | 6478 | 66 |
| FJ859062.1 | Human poliovirus 1 isolate 10094c, complete genome | 3410 | ________...c......... | 3398 | 57 |
| FJ859063.1 | Human poliovirus 1 isolate 10095c, complete genome | 6620 | _...........cc.a..c.. | 6639 | 76 |
| FJ859063.1 | Human poliovirus 1 isolate 10095c, complete genome | 6494 | ____.t....ct......... | 6478 | 66 |
| FJ859063.1 | Human poliovirus 1 isolate 10095c, complete genome | 3410 | ________...c......... | 3398 | 57 |
| FJ859064.1 | Human poliovirus 1 isolate 10097c, complete genome | 6620 | _...........cc.a..c.. | 6639 | 76 |
| FJ859064.1 | Human poliovirus 1 isolate 10097c, complete genome | 6494 | ____.t....ct......... | 6478 | 66 |
| HM107832.1 | Human poliovirus 2 isolate CHN1054, complete genome | 6619 | _...........cc.a..c.. | 6638 | 76 |
| HM107832.1 | Human poliovirus 2 isolate CHN1054, complete genome | 6493 | ____.t....ct......... | 6477 | 66 |
| HM107832.1 | Human poliovirus 2 isolate CHN1054, complete genome | 3409 | ________...c......... | 3397 | 57 |
| HM107833.1 | Human poliovirus 2 isolate CHN1078, complete genome | 6619 | _...........cc.a..c.. | 6638 | 76 |
| HM107833.1 | Human poliovirus 2 isolate CHN1078, complete genome | 6493 | ____.t....ct......... | 6477 | 66 |
| HM107833.1 | Human poliovirus 2 isolate CHN1078, complete genome | 3409 | ________...c......... | 3397 | 57 |
| HM107834.1 | Human poliovirus 2 isolate CHN3219, complete genome | 6619 | _...........cc.a..c.. | 6638 | 76 |
| HM107834.1 | Human poliovirus 2 isolate CHN3219, complete genome | 6493 | ____.t....ct......... | 6477 | 66 |
| HM107834.1 | Human poliovirus 2 isolate CHN3219, complete genome | 3409 | ________...c......... | 3397 | 57 |
| AJ544513.1 | Human poliovirus 2 gene for polyprotein, genomic RNA, isolate 102050 | 3412 | _____..a...c......... | 3397 | 66 |
| D90457.1 | CXA24CG Human coxsackievirus A24 DNA, complete genome | 5678 | ...atc...........____ | 5662 | 66 |
| AF405669.1 | Human poliovirus 1 isolate HAI00003, complete genome | 2862 | ______..........a.a.. | 2876 | 61 |
| AF405682.1 | Human poliovirus 1 isolate DOR00041C1, complete genome | 2861 | ______..........a.a.. | 2875 | 61 |
| AF405690.1 | Human poliovirus 1 isolate DOR00013, complete genome | 2861 | ______..........a.a.. | 2875 | 61 |
| AF458333.1 | Human poliovirus 1 isolate HAI01015, complete genome | 2861 | ______..........a.a.. | 2875 | 61 |
| AY278551.1 | Human poliovirus 2 isolate P2S/Mog66-4 (21043), complete genome | 3409 | ________...c......... | 3397 | 57 |
| AF448782.1 | Human poliovirus 2 strain EGY88-074, complete genome | 3409 | ________...c......... | 3397 | 57 |
| AM040035.1 | Human poliovirus 2 complete virion genome, isolate PV2/4568-1/ISR98 | 3313 | ________...c......... | 3301 | 57 |
| AM040037.1 | Human poliovirus 2 complete virion genome, isolate PV2/5074-18/ISR99 | 3313 | ________...c......... | 3301 | 57 |
| AM040039.1 | Human poliovirus 2 complete virion genome, isolate PV2/5116-9/ISR99 | 3313 | ________...c......... | 3301 | 57 |
| AM084223.1 | Human poliovirus 2 RNA for polyprotein, complete genome, genomic RNA, | 3409 | ________...c......... | 3397 | 57 |
| AM084224.1 | Human poliovirus 2 RNA for polyprotein, complete genome, genomic RNA, | 3409 | ________...c......... | 3397 | 57 |
| DQ890385.1 | Human poliovirus 2 strain NIE0210766, complete genome | 3409 | ________...c......... | 3397 | 57 |
| DQ890386.1 | Human poliovirus 2 strain NIE0110767, complete genome | 3411 | ________...c......... | 3399 | 57 |
| AM884184.1 | Human poliovirus 2, complete genome, genomic RNA, isolate VDPV MAD005 | 3409 | ________...c......... | 3397 | 57 |
| AM884185.1 | Human poliovirus 2, complete genome, genomic RNA, isolate VDPV MAD006 | 3409 | ________...c......... | 3397 | 57 |
| AF499636.1 | Human coxsackievirus A11 strain Belgium-1, complete genome | 5662 | ______...........____ | 5652 | 52 |
| AF499643.1 | Human coxsackievirus A22 strain Chulman, complete genome | 1446 | ____.g.g..a........._ | 1431 | 61 |
| AF499641.1 | Human coxsackievirus A19 strain 8663, complete genome | 2828 | ______..........a.c._ | 2841 | 57 |
| AB205396.1 | Human coxsackievirus A18 genomic RNA, complete genome, strain: CAM197 | 2884 | ______..........a.a._ | 2897 | 57 |
| AF111966.2 | Human poliovirus 1 isolate CHN-Hainan/93-2, complete genome | 4550 | ________..........___ | 4541 | 47 |
| AY876912.1 | Human enterovirus Ningbo3-02, complete genome | 2873 | ______.........._____ | 2882 | 47 |
| AY876913.1 | Human enterovirus Hangzhou13-02, complete genome | 2873 | ______.........._____ | 2882 | 47 |
| DQ443001.1 | Human coxsackievirus A24 isolate DSO-52/2005, complete genome | 2878 | ______.........._____ | 2887 | 47 |
| DQ443002.1 | Human coxsackievirus A24 isolate DSO-26/2005, complete genome | 2878 | ______.........._____ | 2887 | 47 |